Detail of Probeset Mtr.19920.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.19920.1.S1_s_at
Species Medicago truncatula
Annotation IMGAG|1093.m00025 /FEA=mRNA /DEF=LQGC hypothetical protein AC146562.17.241 99926 100099 mth2-14d10 01/13/05
Mapped public sequence ID IMGAG|1093.m00025
Gene Ontology GO:0000502 GO:0004175 GO:0005515 GO:0005634 GO:0005730 GO:0005737 GO:0031145 GO:0051436 GO:0051437
KEGG K00517 K03030 K09587
Transporter 3.A.1 3.A.1.208 3.A.1.208.14
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence atgaaggtttggttctgccacggaaatcgtggtacgatttctggtggcgtgg