| Detail of Probeset Mtr.19920.1.S1_x_at in Chip AffyMedicago |
| Probeset ID |
Mtr.19920.1.S1_x_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1093.m00025 /FEA=mRNA /DEF=LQGC hypothetical protein AC146562.17.241 99926 100099 mth2-14d10 01/13/05 |
| Mapped public sequence ID |
IMGAG|1093.m00025 |
| Gene Ontology |
GO:0000502 GO:0004175 GO:0005515 GO:0005634 GO:0005730 GO:0005737 GO:0031145 GO:0051436 GO:0051437 |
| KEGG |
K00517 K03030 K09587 |
| Transporter |
3.A.1 3.A.1.208 3.A.1.208.14 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tttctggtggcgtggcacgatttttcagaatcgtggcgcgattttatgaggcgtggcgcg
attttggacgcagaaaatgttgcctatttaagctgaagactattctgaaaacaagggtta
cgattttggagagcta |