| Detail of Probeset Mtr.20043.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.20043.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1098.m00018 /FEA=mRNA /DEF=Chain A, Low Resolution Solution Structure Of The Two Dna-Binding Domains In Schizosaccharomyces Pombe Abp1 Protein., putative AC146569.5.181 81104 81499 mth2-102a8 01/13/05 |
| Mapped public sequence ID |
IMGAG|1098.m00018 |
| Gene Ontology |
GO:0000780 GO:0000790 GO:0005515 GO:0005634 GO:0005737 GO:0006270 GO:0007059 GO:0016570 GO:0019237 GO:0030702 GO:0046983 |
| KEGG |
K11496 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
ES611423 |
| Target sequence |
atacgtaaggagttgtgcgagtacaagagagataatcctgcaagcacacaaaaagacttg
cagagatggcttgagggaaaatttcagttgaaagttagtcaaggaacaatatcaaacaca
cttaagcggtcaaatgactatctctctgctgaaatagaaaagggaagagcggagatcaaa
agacacaaaccaacaaaatatcctgacatggagaaggttg |
