| Detail of Probeset Mtr.20044.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.20044.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1098.m00020 /FEA=mRNA /DEF=conserved hypothetical protein AC146569.5.201 82351 82608 mth2-102a8 01/13/05 |
| Mapped public sequence ID |
IMGAG|1098.m00020 |
| Gene Ontology |
GO:0000780 GO:0000790 GO:0005515 GO:0005634 GO:0005737 GO:0006270 GO:0007059 GO:0016570 GO:0019237 GO:0030702 GO:0046983 |
| KEGG |
K11496 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tgtctttggagcctgttacgcgaaaggaagcatttatggcgtcgaacactcttcacaact
ttatgatacaatac |
