Detail of Probeset Mtr.20070.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.20070.1.S1_at
Species Medicago truncatula
Annotation IMGAG|1202.m00003 /FEA=mRNA /DEF=WD-40 repeat AC148292.8.31 19449 16273 mth2-15m24 01/13/05
Mapped public sequence ID IMGAG|1202.m00003
Gene Ontology GO:0005739 GO:0005794 GO:0005886 GO:0015386 GO:0015672 GO:0016021 GO:0030007
KEGG K03455
Transporter 2.A.37 2.A.37.2.1 2.A.37.4.1
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence cgaaaacacttatgataccacgacattcatctcaaatatagcgatt