| Detail of Probeset Mtr.20250.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.20250.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1208.m00019 /FEA=mRNA /DEF=Mitochondrial substrate carrier AC148360.10.181 58434 58685 mth2-27i5 01/13/05 |
| Mapped public sequence ID |
IMGAG|1208.m00019 |
| Gene Ontology |
GO:0005488 GO:0005743 GO:0006810 GO:0015228 GO:0015880 GO:0005739 GO:0015300 GO:0005347 GO:0005509 GO:0006817 GO:0015114 GO:0015217 GO:0015866 GO:0015867 |
| KEGG |
K05863 K16282 K20580 K22721 |
| Transporter |
2.A.29 2.A.29.23.1 2.A.29.12.1 2.A.29.22.1 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
CB894600 TCMT47935
|
| Target sequence |
aagcaaggctggaagaccctgttttcagggctgagtatcaattacataaaggttgttcca
tctgcggccattggcttcacagtttatgatactatgaaatcatacttgagagtaccatca
agagatgaagtggact |
