| Detail of Probeset Mtr.20259.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.20259.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1106.m00015 /FEA=mRNA /DEF=Protein kinase; Serine/threonine protein kinase, active site; Leucine-rich repeat; Leucine-rich repeat, plant specific; Tyrosine protein kinase; Protein kinase-like AC146586.2.151 58067 64102 mth2-71m12 01/13/05 |
| Mapped public sequence ID |
IMGAG|1106.m00015 |
| Gene Ontology |
GO:0004674 GO:0005515 GO:0005887 |
| KEGG |
K00924 K04733 |
| Transporter |
1.A.26 1.A.26.1.1 |
| Transcription Factor |
WRKY |
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
ctgtatcagaaaccagtctttcaggtagataa |