Detail of Probeset Mtr.20397.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.20397.1.S1_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|1216.m00004 /FEA=mRNA /DEF=Amidase, hydantoinase/carbamoylase; Peptidase M20; Peptidase dimerisation AC148487.14.41 15700 20006 mth2-57f20 01/13/05 |
Mapped public sequence ID |
IMGAG|1216.m00004 |
Gene Ontology |
GO:0006508 GO:0008233 GO:0008652 GO:0009063 GO:0050538 |
KEGG |
K06016 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
TCMT49917 |
Target sequence |
cgttggcactgttggtatcctgcaactgcatcctggagcaatcaatagcatccctagcaa
atcacacatagaaattgatactagggaca |