Detail of Probeset Mtr.20397.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.20397.1.S1_at
Species Medicago truncatula
Annotation IMGAG|1216.m00004 /FEA=mRNA /DEF=Amidase, hydantoinase/carbamoylase; Peptidase M20; Peptidase dimerisation AC148487.14.41 15700 20006 mth2-57f20 01/13/05
Mapped public sequence ID IMGAG|1216.m00004
Gene Ontology GO:0006508 GO:0008233 GO:0008652 GO:0009063 GO:0050538
KEGG K06016
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database TCMT49917  
Target sequence cgttggcactgttggtatcctgcaactgcatcctggagcaatcaatagcatccctagcaa
atcacacatagaaattgatactagggaca