| Detail of Probeset Mtr.20470.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.20470.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1112.m00003 /FEA=mRNA /DEF=Aspartate carbamoyltransferase; Aspartate/ornithine carbamoyltransferase; Ornithine carbamoyltransferase; Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain; Aspartate/ornithine carbamoyltransferase, Asp/ |
| Mapped public sequence ID |
IMGAG|1112.m00003 |
| Gene Ontology |
GO:0004070 GO:0004086 GO:0004088 GO:0005575 GO:0006207 GO:0006520 GO:0006807 GO:0016597 GO:0016743 GO:0016812 GO:0016874 GO:0019856 |
| KEGG |
K00609 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT57247 |
| Target sequence |
ggtgctgccagaagagctgcagctattgctggcattccaatagtcaatgcgggggatgga
cctggacaacatccgacccaggcacttttggatgtctatacaattgaaagagagattgga
aagcttgatggtatta |
