| Detail of Probeset Mtr.20554.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.20554.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1114.m00020 /FEA=mRNA /DEF=Phenylalanyl-tRNA synthetase, class IIc; Phenylalanyl-tRNA synthetase, alpha subunit; Aminoacyl-transfer RNA synthetase, class II AC146682.7.201 81872 89042 mth2-161d9 01/13/05 |
| Mapped public sequence ID |
IMGAG|1114.m00020 |
| Gene Ontology |
GO:0004826 GO:0005625 GO:0005737 GO:0009328 GO:0000003 GO:0002119 GO:0009790 GO:0009792 GO:0010171 GO:0040007 GO:0040010 |
| KEGG |
K01889 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT43932 |
| Target sequence |
catgaatctggtggatatgagtctaggggatatgcatatgactggaaaagagaggaagca
aataaaaaccttctgcggacccacacaactgctgtttcttcccggatgctttaccagctg
gcacagaaaccattttctccaaaa |
