| Detail of Probeset Mtr.20557.1.S1_x_at in Chip AffyMedicago |
| Probeset ID |
Mtr.20557.1.S1_x_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1222.m00020 /FEA=mRNA /DEF=LQGC hypothetical protein AC148775.2.191 99010 98797 mth2-62i21 01/13/05 |
| Mapped public sequence ID |
IMGAG|1222.m00020 |
| Gene Ontology |
GO:0000780 GO:0000790 GO:0005515 GO:0005634 GO:0005737 GO:0006270 GO:0007059 GO:0016570 GO:0019237 GO:0030702 GO:0046983 |
| KEGG |
K11496 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
aaaccagtgttaaattcatacttagggttaccggaacctggagatctcgccggagaagac
gaagtttccggcggacctatgaaggttccggctagaccttcatcttctccggccgctcaa
tccagaaaccggcgaggga |
