| Detail of Probeset Mtr.20613.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.20613.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1118.m00002 /FEA=mRNA /DEF=Werner Syndrome-like exonuclease AC146705.11.21 10059 13624 mth2-101f3 01/13/05 |
| Mapped public sequence ID |
IMGAG|1118.m00002 |
| Gene Ontology |
GO:0000403 GO:0000405 GO:0000723 GO:0000731 GO:0001302 GO:0003677 GO:0003678 GO:0004003 GO:0004527 GO:0005634 GO:0005654 GO:0005730 GO:0005813 GO:0006259 GO:0006260 GO:0006284 GO:0006974 GO:0006979 GO:0008408 GO:0009378 GO:0010225 GO:0010259 GO:0016887 GO:0031297 GO:0032389 GO:0032403 GO:0040009 GO:0042803 GO:0042981 GO:0043138 GO:0051345 GO:0051880 |
| KEGG |
K10900 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
agtggagacccaccttcaaaagaggtgttccacccgggaaaacagcagtgatgcagatat
gttgtgacactaatcattgtcttgttcttcatctaattcattctggaatccctcgaaatc
tacagcttctacttgaagattcctcagttttgaaggttggagcggggattggcggtgatg
cttctaaggtttcgagagattatttcatatccattaaaggtgtggaagacctttcttatc
acgctaatcaaaagc |