Detail of Probeset Mtr.20763.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.20763.1.S1_at
Species Medicago truncatula
Annotation IMGAG|1122.m00019 /FEA=mRNA /DEF=ATP sulfurylase-related AC146721.7.191 117828 117667 mth2-145n10 01/13/05
Mapped public sequence ID IMGAG|1122.m00019
Gene Ontology GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0005739 GO:0008233 GO:0032197
KEGG K00140 K15001 K18599 K22300
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence gaaacggtgttgtaaatccggctcaactaatgaaccttcacaccaatga