| Detail of Probeset Mtr.20773.1.S1_a_at in Chip AffyMedicago |
| Probeset ID |
Mtr.20773.1.S1_a_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1231.m00008 /FEA=mRNA /DEF=KH, type 1; KH, type 2 AC148971.3.71 30641 35362 mth2-79e23 01/13/05 |
| Mapped public sequence ID |
IMGAG|1231.m00008 |
| Gene Ontology |
GO:0003723 GO:0005515 |
| KEGG |
K10610 K16164 K21481 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
BF635859 |
| Target sequence |
ttggaggccaatcctctttacaatctgataccagtccctatgggagactgagagatattc
cacttggaggccaatcctctttacaatctgataccagtccctatgggaaactgagagata
ttccacttggaggccaatc |
