| Detail of Probeset Mtr.21184.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.21184.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1145.m00001 /FEA=mRNA /DEF=hypothetical protein AC146842.9.1 430 336 mth2-10a3 01/13/05 |
| Mapped public sequence ID |
IMGAG|1145.m00001 |
| Gene Ontology |
GO:0001570 GO:0003723 GO:0005515 GO:0005634 GO:0005737 GO:0007283 GO:0008366 GO:0042552 GO:0042692 GO:0042759 |
| KEGG |
K14241 K17902 K22901 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT52851 TCMT52850
|
| Target sequence |
tcagatttcctcaccaggaacagcaagggctaa |