| Detail of Probeset Mtr.21209.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.21209.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1245.m00005 /FEA=mRNA /DEF=Small GTP-binding protein domain; Sigma-54 factor, interaction region; Ras GTPase; ADP-ribosylation factor; Ras small GTPase, Rab type; Ras small GTPase, Ras type; Ras small GTPase, Rho type; GTP-binding nuclear protein Ra |
| Mapped public sequence ID |
IMGAG|1245.m00005 |
| Gene Ontology |
|
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
aaaaaacgctctttgttcatgaagttgaatgtctgtttttacattgcagccgtcaagaat
tagaatcaacaaacacaacaatgcaactgcagcacgtggttcacagaagtcggaatgctg
tggttgaggaagcagaattgctgttcaggatcaagaaggaggaaaatacatgtatgatga
gattgatgatgacttcttttgtgtttaaccttgtcattctttcagaatttc |
