| Detail of Probeset Mtr.21343.1.S1_x_at in Chip AffyMedicago |
| Probeset ID |
Mtr.21343.1.S1_x_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1250.m00022 /FEA=mRNA /DEF=hypothetical protein AC149307.17.211 103724 103969 mth2-91a15 01/13/05 |
| Mapped public sequence ID |
IMGAG|1250.m00022 |
| Gene Ontology |
GO:0004140 GO:0005575 GO:0008150 GO:0015937 GO:0005737 GO:0006805 GO:0008146 GO:0005515 GO:0000055 GO:0000079 GO:0003674 GO:0005634 GO:0005635 GO:0005783 GO:0006611 |
| KEGG |
K00859 K01025 K10268 K14201 K21630 |
| Transporter |
|
| Transcription Factor |
bHLH |
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
aaaaatcacctatgacgtggcatggaattgtttgcgatggttccgaaaaaaagaagggtt
cgaaggtgccagtgtacaatcactcgaggttgaggaggagcgggaggatatgctatttcg
gtcctcaaccaaaacaaggtaccgcagggactgtagcggacaagccgattgatttgtgtg
acga |
