Detail of Probeset Mtr.21377.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.21377.1.S1_at
Species Medicago truncatula
Annotation IMGAG|1152.m00004 /FEA=mRNA /DEF=Transcription factor E2F/dimerisation partner (TDP) AC146914.8.31 17755 20960 mth2-57l14 01/13/05
Mapped public sequence ID IMGAG|1152.m00004
Gene Ontology GO:0003700 GO:0005634 GO:0008285 GO:0016564 GO:0042802 GO:0045449
KEGG K09391
Transporter
Transcription Factor E2F-DP
Mapped unigene in the TRICHOME database BQ148893  
Target sequence aacaatgagaattccatctggccttgcagcaaaagtcaggcgcc