Detail of Probeset Mtr.21636.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.21636.1.S1_at
Species Medicago truncatula
Annotation IMGAG|1162.m00022 /FEA=mRNA /DEF=Concanavalin A-like lectin/glucanase; Calreticulin/calnexin; Endoplasmic reticulum targeting sequence AC147179.15.221 103677 108687 mth2-142n19 01/13/05
Mapped public sequence ID IMGAG|1162.m00022
Gene Ontology GO:0000122 GO:0001849 GO:0003677 GO:0005178 GO:0005509 GO:0005634 GO:0005783 GO:0005788 GO:0005813 GO:0005829 GO:0006355 GO:0006611 GO:0006911 GO:0007050 GO:0008284 GO:0016564 GO:0017148 GO:0022417 GO:0033144 GO:0042921 GO:0042981 GO:0045335 GO:0045665 GO:0045740 GO:0048387 GO:0048471 GO:0050681 GO:0050821 GO:0051087 GO:0051208 GO:0051707 GO:0005811 GO:0007417 GO:0007422 GO:0042048
KEGG K08057
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database CB891329  TCMT46552  
Target sequence gcagactgggaagacagagaatacattgaagaccctaatgctgtcaaacctgagggatat
g