| Detail of Probeset Mtr.21646.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.21646.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|1163.m00014 /FEA=mRNA /DEF=Plant metallothionein, family 15 AC147202.14.141 55222 54140 mth2-165g15 01/13/05 |
| Mapped public sequence ID | IMGAG|1163.m00014 |
| Gene Ontology | GO:0005634 GO:0005737 GO:0005829 GO:0006166 GO:0006218 GO:0008477 GO:0008655 GO:0033554 GO:0045437 |
| KEGG | K01193 K01249 K02699 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40401 BQ157886 BQ146755 TCMT41752 BQ151583 TCMT41161 TCMT42348 BF006085 TCMT41710 BQ151978 AL388885 BQ150850 TCMT41851 TCMT42234 TCMT41582 BQ143895 AW774197 |
| Target sequence | agtgcctgcaaatgcggcaatggctgtggaggctgcaagatgtaccctgacttgagctac |