| Detail of Probeset Mtr.21646.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.21646.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1163.m00014 /FEA=mRNA /DEF=Plant metallothionein, family 15 AC147202.14.141 55222 54140 mth2-165g15 01/13/05 |
| Mapped public sequence ID |
IMGAG|1163.m00014 |
| Gene Ontology |
GO:0005634 GO:0005737 GO:0005829 GO:0006166 GO:0006218 GO:0008477 GO:0008655 GO:0033554 GO:0045437 |
| KEGG |
K01193 K01249 K02699 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMS40401 BQ157886
BQ146755 TCMT41752
BQ151583 TCMT41161
TCMT42348 BF006085
TCMT41710 BQ151978
AL388885 BQ150850
TCMT41851 TCMT42234
TCMT41582 BQ143895
AW774197 |
| Target sequence |
agtgcctgcaaatgcggcaatggctgtggaggctgcaagatgtaccctgacttgagctac
acagaatcaaccacctctgagacccttgtgatgggagttgcatctgccaagcctcaattt
gaaggtgctgctgaaatgggtgctgagaatgatggctgcaagtgtggtccaaactgcaac
tgcaacccatgcacttgcaaat |