| Detail of Probeset Mtr.21727.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.21727.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1172.m00032 /FEA=mRNA /DEF=Proteinase inhibitor I25A and I25B, type 2 and phytocystatins; Proteinase inhibitor I25, cystatin AC147430.9.311 122605 125234 mth2-71e6 01/13/05 |
| Mapped public sequence ID |
IMGAG|1172.m00032 |
| Gene Ontology |
|
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
atgcaaaggctgagggttccgttctgttaaggaagaaaatatgttacaacttgccagatt
ccgttaaatgtgtcattt |
