| Detail of Probeset Mtr.21769.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.21769.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | 1563.m00054 /FEA=mRNA /DEF=AC119410.15 67762 66719 mth2-13n10 weakly similar to TAIR|gene:2169343-GOpep .1 68412.m00735 sulfotransferase family similar to steroid sulfotransferase 3 |
| Mapped public sequence ID | 1563.m00054 |
| Gene Ontology | GO:0005737 GO:0005829 GO:0006805 GO:0008146 GO:0018958 GO:0042403 GO:0005856 |
| KEGG | K01025 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | tggaactcacatgccatttccttcgttgcccaagtca |