Detail of Probeset Mtr.21815.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.21815.1.S1_at |
Species |
Medicago truncatula |
Annotation |
1566.m00060 /FEA=mRNA /DEF=AC119414.39 77863 79912 mth2-23d7 weakly similar to TIGR_Ath1|At4g10500-GOpep .1 68411.m01556 oxidoreductase, 2OG-Fe(II) oxygenase family similar to, partial (94%) |
Mapped public sequence ID |
1566.m00060 |
Gene Ontology |
GO:0005506 GO:0005575 GO:0008152 GO:0009693 GO:0009815 GO:0016491 |
KEGG |
K00475 K05277 K05278 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
N/A |
Target sequence |
agaattgaccatgggactgcttgaacatactgatctcaat |