| Detail of Probeset Mtr.21815.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.21815.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1566.m00060 /FEA=mRNA /DEF=AC119414.39 77863 79912 mth2-23d7 weakly similar to TIGR_Ath1|At4g10500-GOpep .1 68411.m01556 oxidoreductase, 2OG-Fe(II) oxygenase family similar to, partial (94%) |
| Mapped public sequence ID | 1566.m00060 |
| Gene Ontology | GO:0005506 GO:0005575 GO:0008152 GO:0009693 GO:0009815 GO:0016491 |
| KEGG | K00475 K05277 K05278 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | agaattgaccatgggactgcttgaacatactgatctcaat |