| Detail of Probeset Mtr.21818.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.21818.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
1566.m00063 /FEA=mRNA /DEF=AC119414.39 88260 89597 mth2-23d7 weakly similar to UP|Q8RV60 (Q8RV60) Hypothetical protein At2g05640 |
| Mapped public sequence ID |
1566.m00063 |
| Gene Ontology |
GO:0000287 GO:0000784 GO:0003674 GO:0005524 GO:0005575 GO:0008150 GO:0017116 GO:0032204 GO:0033682 GO:0042162 GO:0043141 GO:0051974 |
| KEGG |
K01529 K23961 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
gaaagcgcaggagatcctcttgctgctattgttgaaagcatgtatcctaacatcttggag
agcatgagtgacatttgttactttcaaaatagagctatattaacaacaaaaaatttcata
gtcgagaagatcaacgactatatgttggacatggttc |