| Detail of Probeset Mtr.21882.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.21882.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | 1570.m00044 /FEA=mRNA /DEF=AC122724.28 95107 92521 mth2-14m14 weakly similar to UP|Q9LXF5 (Q9LXF5) Hypothetical protein F8M21_160 |
| Mapped public sequence ID | 1570.m00044 |
| Gene Ontology | GO:0005575 GO:0008150 |
| KEGG | K10610 K10958 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT56158 |
| Target sequence | aactttctctccaaccgtagaggcagctgtgcttttgcaaccccgatgcagtgaaaaaag |