| Detail of Probeset Mtr.22049.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.22049.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1581.m00031 /FEA=mRNA /DEF=AC126783.24 6891 7334 mth2-15k17 similar to TIGR_Ath1|At1g70600-GOpep .1 68408.m07459 60S ribosomal protein L27A (RPL27aC) identical to 60S ribosomal, complete |
| Mapped public sequence ID | 1581.m00031 |
| Gene Ontology | GO:0003735 GO:0005840 GO:0006412 GO:0009792 |
| KEGG | K02900 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40587 TCMT40086 BQ154254 |
| Target sequence | gaagcgcggccacgtcagtgccggtcacggtcgtatcggaaaacaccgcaagcatcccgg |