| Detail of Probeset Mtr.22093.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.22093.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
1583.m00096 /FEA=mRNA /DEF=AC127428.34 154602 152922 mth2-36c19 weakly similar to TAIR|gene:2018051-GOpep .1 68408.m06444 WRKY family transcription factor similar to putative DNA-binding |
| Mapped public sequence ID |
1583.m00096 |
| Gene Ontology |
GO:0003677 GO:0005634 GO:0006355 GO:0008270 |
| KEGG |
|
| Transporter |
|
| Transcription Factor |
WRKY |
| Mapped unigene in the TRICHOME database |
TCMT50999 ES612373
|
| Target sequence |
tgctgatcaagccaatgcagaagccactatgagaaaagcacgagtctcagtccgtgctag
atcagaagcccacatgatca |