| Detail of Probeset Mtr.22126.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.22126.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
1584.m00051 /FEA=mRNA /DEF=AC127674.21 102277 100000 mth2-20a12 weakly similar to UP|Q6L3I4 (Q6L3I4) Hypothetical protein |
| Mapped public sequence ID |
1584.m00051 |
| Gene Ontology |
GO:0003779 GO:0007626 GO:0007628 GO:0016358 GO:0021680 GO:0030425 GO:0043025 GO:0003674 GO:0005515 GO:0005883 GO:0008150 |
| KEGG |
K10443 K10454 K10465 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
ttatgtccttggtgggatagcagctgaaaaaaaaacacagcttacatgtggggaggagtt
tgatatgaagacaaaaaaatggcgtgaaatacctaacatgttccccgtacgaactggagt
gtttgagacaccaccttcttttgggtcacctcctttgattgcagttgtaaaaaatgtatt
gtatgctgcagattatggacaac |
