| Detail of Probeset Mtr.22172.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.22172.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1587.m00041 /FEA=mRNA /DEF=AC130802.18 86876 84673 mth2-28b21 weakly similar to TIGR_Ath1|At1g79940-GOpep .1 68408.m08561 DnaJ protein family similar to SP|Q9UGP8 Translocation protein, partial (51%) |
| Mapped public sequence ID | 1587.m00041 |
| Gene Ontology | GO:0000003 GO:0005047 GO:0005785 GO:0040018 |
| KEGG | K09540 |
| Transporter | 3.A.5 3.A.5.8.1 3.A.5.9.1 |
| Transcription Factor | C2H2 |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | gctgtaactgctgcttctaaggcaattgcagaatctaaggagggttccggagc |