| Detail of Probeset Mtr.22238.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.22238.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
1591.m00026 /FEA=mRNA /DEF=AC130963.22 11695 10562 mth2-36c15 weakly similar to TAIR|gene:2052004-GOpep .1 68409.m02103 CCCH-type zinc finger protein -related |
| Mapped public sequence ID |
1591.m00026 |
| Gene Ontology |
GO:0002164 GO:0003677 GO:0005515 GO:0005737 GO:0007476 GO:0008270 GO:0008407 GO:0048749 |
| KEGG |
K12832 |
| Transporter |
|
| Transcription Factor |
C3H |
| Mapped unigene in the TRICHOME database |
TCMT58988 |
| Target sequence |
acacgccggaacagcttcgtcttaacgttcagcagagtccatcttcctcacggagtgtta
attcgcctgattcgtatgacggttctccgttacgacaaatggttactataacgacgccgc
cagaatctccaccgatgtcaccgatggcgagcgagatggtggcgtcgttacggaatttac
aattgggtcggatgaaaactatgccaattaatagaaatgttacaattgggtcaccgg |
