| Detail of Probeset Mtr.22949.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.22949.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | 1639.m00056 /FEA=mRNA /DEF=AC140024.7 105426 107247 mth2-5f21 weakly similar to UP|Q7XA30 (Q7XA30) Putative receptor protein kinase |
| Mapped public sequence ID | 1639.m00056 |
| Gene Ontology | GO:0005515 |
| KEGG | K00924 K04733 |
| Transporter | 1.A.26 1.A.26.1.1 |
| Transcription Factor | WRKY |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | gtatggcaaggatgtttacacaactggaatccacagtaaataccaaccggattgt |