| Detail of Probeset Mtr.23051.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.23051.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1648.m00032 /FEA=mRNA /DEF=AC142506.27 12789 15865 mth2-25k8 similar to TIGR_Ath1|At4g30260-GOpep .1 68411.m03927 expressed protein similar to expressed protein [Arabidopsis, complete |
| Mapped public sequence ID | 1648.m00032 |
| Gene Ontology | GO:0003674 GO:0008150 GO:0009792 GO:0016021 GO:0005634 GO:0005730 GO:0005737 GO:0005783 |
| KEGG | K24331 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT49736 CA920590 DW016231 |
| Target sequence | agtctgaggtttttgcggttgcatttgccttacttgctgctggtgctgtaattttgacat |