| Detail of Probeset Mtr.23097.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.23097.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | 1650.m00049 /FEA=mRNA /DEF=AC144513.18 97268 98829 mth2-15d23 weakly similar to TAIR|gene:2143334-GOpep .1 68412.m03047 hypothetical protein predicted proteins, Drosophila melanogaster, |
| Mapped public sequence ID | 1650.m00049 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | EX523223 TCMT46653 EY476649 GE345055 TCMT46652 |
| Target sequence | agaccgcgacaacaaggactcccttaagatccgaaagaaatctaagtctcactctcacgc |