| Detail of Probeset Mtr.23109.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.23109.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | 1651.m00046 /FEA=mRNA /DEF=AC144563.10 95679 94495 mth2-5c24 homologue to UP|Q9AT55 (Q9AT55) S-adenosyl-L-methionine synthetase (EC 2.5.1.6) |
| Mapped public sequence ID | 1651.m00046 |
| Gene Ontology | GO:0004478 GO:0005737 GO:0006555 GO:0045335 GO:0048269 GO:0005524 GO:0005634 GO:0005829 GO:0005515 GO:0006556 |
| KEGG | K00789 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40706 TCMT55679 TCMT55678 |
| Target sequence | actcaacacgacgagactgtcagtaacgaccagattgctgctgatcttaaggaacatgtt |