Detail of Probeset Mtr.23228.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.23228.1.S1_at
Species Medicago truncatula
Annotation 1661.m00045 /FEA=mRNA /DEF=AC145109.33 24251 23742 mth2-25f20
Mapped public sequence ID 1661.m00045
Gene Ontology GO:0000077 GO:0000723 GO:0001701 GO:0001832 GO:0003684 GO:0005634 GO:0005657 GO:0006302 GO:0007095 GO:0008134 GO:0008283 GO:0030870 GO:0031575 GO:0042405 GO:0045190 GO:0047485 GO:0048145 GO:0050885
KEGG K10867
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database ES611632  
Target sequence ttgctcaaaaatccgcctgccatgtgtattggagacccaatggaaaattgacacctggac
tgttttggacttaaggactaatctacaaaa