| Detail of Probeset Mtr.23370.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.23370.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
1669.m00046 /FEA=mRNA /DEF=AC145513.23 68802 62581 mth2-26m10 weakly similar to TIGR_Ath1|At5g36930-GOpep .1 68412.m03974 disease resistance protein (TIR-NBS-LRR class), putative domain, partial (72%) |
| Mapped public sequence ID |
1669.m00046 |
| Gene Ontology |
|
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
gtgaaggaccttctgtattatttcaagttcccgacgataccaattactgcatgaagggaa
tga |