| Detail of Probeset Mtr.23387.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.23387.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
1670.m00052 /FEA=mRNA /DEF=AC146307.18 81668 81189 mth2-9p17 homologue to UP|HS12_MEDSA (P27880) 18.2 kDa class I heat shock protein |
| Mapped public sequence ID |
1670.m00052 |
| Gene Ontology |
GO:0005515 GO:0009408 GO:0050821 |
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT55726 |
| Target sequence |
tggagcgcagcagcggaaagttcatgaggagattcaggttgcccgaaaatgcgaaaatgg
at |
