| Detail of Probeset Mtr.23797.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.23797.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
1696.m00038 /FEA=mRNA /DEF=AC147484.17 20161 19837 mth2-52b4 similar to UP|BRU1_SOYBN (P35694) Brassinosteroid-regulated protein BRU1 precursor |
| Mapped public sequence ID |
1696.m00038 |
| Gene Ontology |
GO:0005619 GO:0006112 GO:0007047 GO:0009277 GO:0009986 GO:0016810 GO:0030445 GO:0030446 GO:0030476 |
| KEGG |
K08235 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT42155 AW687589
|
| Target sequence |
gcaatttcaaagctactgagttatcttctgtctcttccacttccttctctgattctgcat
tgcaaagcaatgagcttgatgcttatggtagaagaagattgagatgggttcagaaatact
ttatgatctataattactgcaacgatcttaagcgattcccagaaggtattcctgctgagt
gtaagcgtccaaggttctg |
