| Detail of Probeset Mtr.23947.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.23947.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
1704.m00061 /FEA=mRNA /DEF=AC148346.11 95519 95899 mth2-25m19 |
| Mapped public sequence ID |
1704.m00061 |
| Gene Ontology |
GO:0000209 GO:0000502 GO:0004842 GO:0005575 GO:0006508 GO:0006513 GO:0006950 GO:0016567 GO:0030437 GO:0043162 GO:0045454 GO:0048308 GO:0051248 |
| KEGG |
K06689 |
| Transporter |
9.A.5 9.A.5.1.1 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT46862 |
| Target sequence |
gagtaacttccacaagtatgcagaaaataataaatatggcaaaagaagaacattgcttgg
aggcctaaatgtaggtgttgatggtcagatcgatcatgtggaaactgctgacgaaggact
tgagttaacgaatgtgctggtggtcagaatgattgtgtggaagtttgttgtgtcatag |
