Detail of Probeset Mtr.24170.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.24170.1.S1_at
Species Medicago truncatula
Annotation 1718.m00050 /FEA=mRNA /DEF=AC149547.14 82681 85675 mth2-71b14 weakly similar to TIGR_Ath1|At4g35880-GOpep .1 68411.m04631 expressed protein predicted proteins, Arabidopsis thaliana, partial (79%)
Mapped public sequence ID 1718.m00050
Gene Ontology GO:0004190 GO:0006508 GO:0016020 GO:0035071 GO:0048102
KEGG K00924 K01386 K06002
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence tgttatgatatgagtcctgattcaaatactagcttgatccctagcatgagtttaactatg
ggaggtggaa