Detail of Probeset Mtr.24209.1.S1_x_at in Chip AffyMedicago
Probeset ID Mtr.24209.1.S1_x_at
Species Medicago truncatula
Annotation 1722.m00037 /FEA=mRNA /DEF=AC149581.8 54623 54922 mth2-126m13
Mapped public sequence ID 1722.m00037
Gene Ontology GO:0005515 GO:0005575 GO:0008150 GO:0016798 GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0008233 GO:0032197 GO:0005634
KEGG K01188 K01198 K05349 K07497
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence tggcgattatgcgacttgactatgctgctgctgttat