| Detail of Probeset Mtr.24314.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.24314.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
1732.m00027 /FEA=mRNA /DEF=AC150505.11 4349 3229 mth2-99l2 |
| Mapped public sequence ID |
1732.m00027 |
| Gene Ontology |
GO:0005575 GO:0005634 GO:0002119 GO:0009792 GO:0015992 GO:0016021 GO:0018996 GO:0040007 GO:0040010 GO:0040011 GO:0040035 GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 GO:0003755 GO:0005739 GO:0006457 GO:0006916 GO:0006979 GO:0051881 |
| KEGG |
K00140 K02155 K04773 K05864 K07497 K15001 K22300 |
| Transporter |
3.A.2 3.A.2.2.3 9.B.16.1.1 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tagacaggcgcaagctgctcttggatcgagctagccacttgagcgaacagaaacagatag
a |
