| Detail of Probeset Mtr.24416.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.24416.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1739.m00053 /FEA=mRNA /DEF=AC151424.10 66228 64912 mth2-101c17 similar to TAIR|gene:2159965-GOpep .1 68412.m04715 expressed protein similar to unknown protein (pir||T28068) |
| Mapped public sequence ID | 1739.m00053 |
| Gene Ontology | GO:0004303 GO:0005498 GO:0005515 GO:0005777 GO:0005811 GO:0006694 |
| KEGG | K00022 K08078 K08764 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40210 TCMT40287 BQ144329 |
| Target sequence | aaacaacacttttcaaccgacgctggcaaaaaactcaccgaaaaaattggtctcgtttat |