| Detail of Probeset Mtr.24829.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.24829.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1771.m00037 /FEA=mRNA /DEF=AC152818.10 24593 21961 mth2-85g12 weakly similar to TIGR_Ath1|At2g16670-GOpep .1 68409.m01723 retroelement pol polyprotein -related, partial (30%) |
| Mapped public sequence ID | 1771.m00037 |
| Gene Ontology | GO:0004565 GO:0005515 GO:0005990 GO:0004349 GO:0004350 GO:0005739 GO:0005743 GO:0005811 GO:0006561 GO:0017084 GO:0040010 |
| KEGG | K00147 K00931 K01190 |
| Transporter | |
| Transcription Factor | NAC |
| Mapped unigene in the TRICHOME database | TCMT42526 BQ144093 BQ158033 BQ152524 TCMT41345 BG588075 AW981470 BE943264 TCMT40753 |
| Target sequence | taagatgagagttatggtgaagactgaagagtactcttctgatcttgtatcactttcact |