| Detail of Probeset Mtr.24836.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.24836.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1771.m00057 /FEA=mRNA /DEF=AC152818.10 119065 117971 mth2-85g12 weakly similar to TIGR_Ath1|At2g35800-GOpep .1 68409.m03978 mitochondrial carrier protein family contains INTERPRO:IPR001993, partial (35%) |
| Mapped public sequence ID | 1771.m00057 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | cacagagtctgaaggtgtgacatcttacatatga |