Detail of Probeset Mtr.24886.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.24886.1.S1_at
Species Medicago truncatula
Annotation 1774.m00057 /FEA=mRNA /DEF=AC152920.7 81595 83481 mth2-101o15 similar to UP|Q6K5H0 (Q6K5H0) Putative nucleotide binding protein
Mapped public sequence ID 1774.m00057
Gene Ontology GO:0005524 GO:0005575 GO:0008150 GO:0005634 GO:0005737 GO:0005829 GO:0016226 GO:0016887 GO:0051539
KEGG K03593 K24826
Transporter 3.A.4 3.A.4.1.1
Transcription Factor
Mapped unigene in the TRICHOME database TCMT55936  TCMT55937  
Target sequence aaggcagccgaagaaggcagatcctgctttgcagataaagattgtgttgtgagcgctcca
gcgttacaaaagattata