| Detail of Probeset Mtr.24992.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.24992.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | 1783.m00045 /FEA=mRNA /DEF=AC153725.3 132408 133645 mth2-78c5 weakly similar to UP|Q5XWK9 (Q5XWK9) Gag-pol polyprotein-like, partial (10%) |
| Mapped public sequence ID | 1783.m00045 |
| Gene Ontology | GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 |
| KEGG | K00140 K13663 K15001 K22300 |
| Transporter | |
| Transcription Factor | WRKY |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | gttcagcagaatgctcctagtagttcaacagtcacccctgaaa |