| Detail of Probeset Mtr.25008.1.S1_x_at in Chip AffyMedicago |
| Probeset ID |
Mtr.25008.1.S1_x_at |
| Species |
Medicago truncatula |
| Annotation |
1785.m00035 /FEA=mRNA /DEF=AC155890.1 9674 8114 mth2-49p3 similar to UP|Q40316 (Q40316) Vestitone reductase |
| Mapped public sequence ID |
1785.m00035 |
| Gene Ontology |
GO:0003824 GO:0005575 GO:0005813 GO:0044237 GO:0045335 GO:0050662 |
| KEGG |
K08695 K09753 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
caccgttaatgccactgttagagatgatccagagcgcaagaaagatgttagcttcctcac
aaatcttccaggtgcatcccaaaagctaaaattcttcagtgctgatctaagtatcccaga
aa |