| Detail of Probeset Mtr.25031.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.25031.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1787.m00036 /FEA=mRNA /DEF=AY515252.1 17279 9359 mth2-50E03 weakly similar to TIGR_Ath1|At1g10930-GOpep .1 68408.m01130 DNA helicase (recQl4A) nearly identical to DNA Helicase, partial (35%) |
| Mapped public sequence ID | 1787.m00036 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | gaccagattatcaggtgtcagagttcgaactctag |