| Detail of Probeset Mtr.25119.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.25119.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
1792.m00025 /FEA=mRNA /DEF=CR931807.1 30869 23568 mte1-84j2 weakly similar to UP|Q6YV15 (Q6YV15) Putative SET domain protein SDG117 |
| Mapped public sequence ID |
1792.m00025 |
| Gene Ontology |
GO:0000122 GO:0000239 GO:0005634 GO:0006357 GO:0007130 GO:0007281 GO:0007286 GO:0009566 GO:0035265 GO:0051567 |
| KEGG |
K11420 |
| Transporter |
|
| Transcription Factor |
PcG |
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
gtggcaggttcccatatgatcataacggtcgattaatattggaggaaggttaccttgtct
acgaatgtaaccgtatgtgcagatgcaataaatcctgtccaaacagaatattgcagaacg
gagtacgggtcaaattggaagtctttaaaacagag |